; Al-Mondhiry, H.A. Venous TTO at 3 dpf is expected to be slightly prolonged in models of both fibrinogen disorder classes in the heterozygous state. The following content was provided by Scott A. Dulchavsky, M.D., Ph.D., and is maintained in a database by the ISS Program Science Office. ; Morgan, F.J. ... Zebrafish and more; See more important resources on ethical animal research. Jagadeeswaran, P.; Sheehan, J.P.; Craig, F.E. Laser injuries were used to induce venous thrombosis and the time-to-occlusion (TTO) and the binding and aggregation of fluorescent, This is an open access article distributed under the, Note that from the first issue of 2016, MDPI journals use article numbers instead of page numbers. Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish. Jagadeeswaran, P.; Sheehan, J.P. Venous thrombosis occurs in patients with quantitative and qualitative fibrinogen disorders. ; Iorio, A.; Makris, M. Thrombosis in Inherited Fibrinogen Disorders. ; Haverkate, F.; Arocha Pinango, C.L. "Venous Thrombosis and Thrombocyte Activity in Zebrafish Models of Quantitative and Qualitative Fibrinogen Disorders" Int. Hanss, M.; Biot, F. A database for human fibrinogen variants. ; Troyer, D. Identification and characterization of zebrafish thrombocytes. Hwang, W.Y. We aimed to determine whether zebrafish models of afibrinogenemia and dysfibrinogenemia have different thrombotic phenotypes. ; Yost, H.J. Casini, A.; de Moerloose, P. Can the phenotype of inherited fibrinogen disorders be predicted? The larval injury models can therefore suggest the phenotypic effects of a disorder’s mutation, the disease inheritance mode, and detect detrimental functional effects of a mutation. We define seven broad periods of embryogenesis—the zygote, cleavage, blastula, gastrula, segmentation, pharyngula, and hatching periods. and M.N.-A. A nontransfected control sample was also prepared. Berget, S.M. At Charles River, you’ll get syngeneic models that have been fully characterized with known checkpoint inhibitors, whole exome sequencing, and immunologic profiling data, backed by experienced scientists who can ensure your model runs smoothly. We aimed to determine whether the experimental venous thrombosis phenotype of afibrinogenemia, a quantitative disorder, differs from that of dysfibrinogenemia—a disorder of fibrinogen quality. Disruption of the kringle 1 domain of prothrombin leads to late onset mortality in zebrafish. The wild-type or mutated Aα plasmids, were cotransfected into HEK-293T cells in 10 cm cell culture dishes with plasmids for the expression of zebrafish fibrinogen Bβ and γ chains, using Lipofectamine 2000 (Thermo Fisher Scientific, Walthum, MA, USA). In the future we aim to use this preliminary guide to assess the phenotype of newly uncovered mutations linked to congenital fibrinogen disorders and take steps towards correlating the larval zebrafish model phenotypes with clinical indicators in patients. Jagadeeswaran, P.; Liu, Y.C. Dupuy, E.; Soria, C.; Molho, P.; Zini, J.M. Please note that many of the page functionalities won't work as expected without javascript enabled. Grzegorski, S.J. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results. ; Campbell, D.S. Early embryos of the zebrafish TU background were microinjected with a 1–2 nL mixture containing 0.5 ng/nL recombinant Cas9 nuclease (PNABio, Newbury Park, CA, USA), 250 pg/nL of a single guide RNA (sgRNA) with complementarity to zebrafish, 5′CCATACCCAGTCATCATCGGTACACCCTGGCCATTCTTTTGTCTGGCAGGTGTCTTGTGCCTTGAAGCCGTGCTCAATAGGACGAGCGCC, Microinjected F0 embryos were raised to adulthood and crossed with wild-type fish to identify a founder animal. ; Boulot, P.; Reyftmann, L.; de Moerloose, P.; Neerman-Arbez, M. Hypodysfibrinogenaemia due to production of mutant fibrinogen alpha-chains lacking fibrinopeptide A and polymerisation knob ‘A’. Animal models of hemophilia and related bleeding disorders. ; Farrell, D.H. Incorporation of fibrin molecules containing fibrinopeptide A alters clot ultrastructure and decreases permeability. All this makes them suitable for studies on human disease and embryological development. Freire, C.; Fish, R.J.; Vilar, R.; Di Sanza, C.; Grzegorski, S.J. ; Chi, N.C.; et al. Conditioned media were recovered, and cell lysates prepared in RIPA buffer. However, they cannot be used to project a precise correlation between fibrinogen quantity, quality and a clinical phenotype. Please note that many of the page functionalities won't work as expected without javascript enabled. Int. https://doi.org/10.3390/ijms22020655, Subscribe to receive issue release notifications and newsletters from MDPI journals, You can make submissions to other journals. We aimed to determine whether zebrafish models of afibrinogenemia and dysfibrinogenemia have different thrombotic phenotypes. Laser injuries were used to induce venous thrombosis and the time-to-occlusion (TTO) and the binding and aggregation of fluorescent, Mutations in the three fibrinogen genes give rise to congenital fibrinogen disorders [, Afibrinogenemia shows recessive inheritance, two mutated alleles of a fibrinogen gene are required for its appearance, and hypofibrinogenemia can be detected in heterozygous carriers of alleles that would cause afibrinogenemia in homozygosity [, While diagnosis can usually be achieved by laboratory tests and genetic studies of the fibrinogen genes, prediction of the clinical phenotype of fibrinogen disorders beyond a bleeding tendency is challenging [, Bleeding events linked to low plasma fibrinogen, or a dysfunctional fibrinogen molecule, can be explained by a deficiency in the quantity or quality of the major physiological substrate for coagulation-based clotting. Orthotopic Tumor Model Studies. ; Shavit, J.A. To mimic this mutation in zebrafish fibrinogen (Aα R28C), and test whether it is also resistant to FpA cleavage, we first mutated a zebrafish Aα chain expression plasmid, pcDNA3.1-ZF-Aα, using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA, USA) and the oligonucleotides fgaR28C-F (5′GGACACAGTGGTGAACCCTTGCGGTGCTCGTCCTATTGAGC3′) and fgaR28C-R (5′GCTCAATAGGACGAGCACCGCAAGGGTTCACCACTGTGTCC3′). See further details. ; project administration, M.N.-A. ; Hu, Z.; Liu, Y.; Yu, X.; Ferguson, A.C.; Madarati, H.; Friedmann, A.P. 2: 655. These authors contributed equally to this work. Popular in aquariums all over the world, the zebrafish is native to South Asia. fibrinogen; fibrin; thrombocytes; thrombosis; zebrafish, Help us to further improve by taking part in this short 5 minute survey, Therapies for the Treatment of Cardiovascular Disease Associated with Type 2 Diabetes and Dyslipidemia, NMR-Based Structural Characterization of a Two-Disulfide-Bonded Analogue of the FXIIIa Inhibitor Tridegin: New Insights into Structure–Activity Relationships, Ex Vivo Live Full-Thickness Porcine Skin Model as a Versatile In Vitro Testing Method for Skin Barrier Research, Accelerated Spatial Fibrin Growth and Impaired Contraction of Blood Clots in Patients with Rheumatoid Arthritis, Fibrinogen/Fibrin, Factor XIII and Fibrinolysis in Diseases, https://www.mdpi.com/1422-0067/22/2/655/s1, http://creativecommons.org/licenses/by/4.0/. Plasma fibrinogen inhibits platelets adhesion in flowing blood to immobilized fibrinogen. ; Hynes, R.O. Zebrafish as a model system for the study of hemostasis and thrombosis. Laser injuries were used to induce venous thrombosis and the time … 22, no. Jagadeeswaran, P.; Carrillo, M.; Radhakrishnan, U.P. A dysfunctional fibrinogen with a deletion of B beta(9-72) corresponding exactly to exon 2 of the gene. We use cookies on our website to ensure you get the best experience. 2021; 22(2):655. De Marco, L.; Girolami, A.; Zimmerman, T.S. ; Nichols, T.C. A hemophilia model in zebrafish: Analysis of hemostasis. ... and neurohistopathology is the study of changes caused by disease at the cellular level in neural tissues. At present, to our knowledge, plasma fibrinogen cannot be measured accurately in larval zebrafish blood due to low blood volumes and a lack of methodology. Find support for a specific problem on the support section of our website. D Zones of Delayed Differentiation. Health Science Center. You seem to have javascript disabled. Khandekar, G.; Kim, S.; Jagadeeswaran, P. Zebrafish thrombocytes: Functions and origins. 2021. We describe a series of stages for development of the embryo of the zebrafish, Danio (Brachydanio) rerio. A CRISPR-Cas9 strategy was used. Casini, A.; Neerman-Arbez, M.; Ariens, R.A.; de Moerloose, P. Dysfibrinogenemia: From molecular anomalies to clinical manifestations and management. These authors contributed equally to this work. Ariens, R.A. Fibrin(ogen) and thrombotic disease. Hu, Z.; Lavik, K.I. ; Rajpurohit, S.K. Babaei, F.; Ramalingam, R.; Tavendale, A.; Liang, Y.; Yan, L.S. Molecular basis for fibrinogen Dusart (A alpha 554 Arg-->Cys) and its association with abnormal fibrin polymerization and thrombophilia. Samples of each were incubated with or without 0.5 U/mL human thrombin (Merck KGaA, Darmstadt, Germany) for 1 h at 37 °C and subjected to western blotting using rabbit anti-zebrafish Aα or Bβ antibodies, as described previously [, We aimed to produce a zebrafish line expressing fibrinogen Aα R28C. The statements, opinions and data contained in the journals are solely Please let us know what you think of our products and services. Mosesson, M.W. Animal models serving in research may have an existing, inbred or induced disease or injury that is similar to a human condition. Sci. Kwan, K.M. Neerman-Arbez, M.; de Moerloose, P.; Casini, A. Weyand, A.C.; Shavit, J.A. Adult zebrafish were maintained at 26 °C, pH 7.5, and 500 µS conductivity. Targeted mutagenesis of zebrafish antithrombin III triggers disseminated intravascular coagulation and thrombosis, revealing insight into function. J. Mol. The software predicted disruption of several ESESs in the mutated sequence (, We did not detect a size shift in the Aα Δ19–56 immunoblot compared to wild-type animals, despite a predicted loss of approximately 4.3kDa and a gel resolution that we would have expected to resolve this difference. De Bosch, N.B. and M.N.-A. ; Neerman-Arbez, M. A genetic modifier of venous thrombosis in zebrafish reveals a functional role for fibrinogen AalphaE in early hemostasis. ; Tsai, S.Q. Injury-induced thrombosis in zebrafish larvae has been used to model human coagulopathies. Zones of delayed neurogenesis, or non-neurogenic zones, are found around the proneural clusters (areas marked 1–4 in Fig. ; Rosenstingl, S.; Laurian, C.; Bruneval, P.; Tobelem, G. Embolized ischemic lesions of toes in an afibrinogenemic patient: Possible relevance to in vivo circulating thrombin. Efficient genome editing in zebrafish using a CRISPR-Cas system. For the present study an obvious limitation is that the disorders we model are diagnosed in part by the concordance of plasma fibrinogen levels and activity. What to know about the COVID-19 vaccine. ; Li, P.; Pugach, E.K. You seem to have javascript disabled. For example, zebrafish are quick to breed, easy to house, and transparent as embryos - but they also carry 70 percent of the genes found in humans. Prisca Chapouton, Leanne Godinho, in Methods in Cell Biology, 2010. ; Lavik, K.I. Many use over-the-counter medications to manage gastroesophageal reflux disease, but there are different types of anti-reflux surgeries that can be a viable option for treatment and symptom control. These studies are carried out primarily using rodent models. ; investigation, R.J.F., C.F. Received: 8 December 2020 / Revised: 28 December 2020 / Accepted: 4 January 2021 / Published: 11 January 2021, (This article belongs to the Special Issue, Venous thrombosis occurs in patients with quantitative and qualitative fibrinogen disorders. ; funding acquisition, M.N.-A. In vivo models (right side) include patient-derived xenografts (PDX) in mouse, zebrafish, and chicken egg chorioallantoic membrane (CAM) hosts. and C.D.S. ... in a mid- to high-throughput manner. Ni, H.; Denis, C.V.; Subbarao, S.; Degen, J.L. We use cookies on our website to ensure you get the best experience. Neerman-Arbez, M.; de Moerloose, P. Mutations in the fibrinogen gene cluster accounting for congenital afibrinogenemia: An update and report of 10 novel mutations. Department of Genetic Medicine and Development, Faculty of Medicine, University of Geneva, 1211 Geneva, Switzerland. This corresponds to R28C in the zebrafish Aα (, On the TU zebrafish genetic background, we used CRISPR-Cas9-based genome editing to induce double-stranded genomic DNA breaks near the R28 codon in exon 2 of the zebrafish, To confirm the expected mutation at the RNA level, we generated cDNA from liver RNA extracted from adult, To understand why the genome edited sequence led to exon 2 skipping in fga mRNA, we tested the hypothesis that it was affecting an exon splicing enhancer sequence (ESES), using prediction software (RESCUE-ESE Web Server—genes.mit.edu). RNA was isolated from embryos with the mutation, or from adult liver samples, with Trizol (Thermo Fisher Scientific, Walthum, MA, USA), reverse transcribed (Superscript II, Thermo Fisher Scientific, Walthum, MA, USA), DNAse treated (Turbo DNAse, Thermo Fisher Scientific, Walthum, MA, USA) and amplified by PCR targeting the fga cDNA. Missense mutations (P59Q; D342E): Milder disease Point mutations → Stop codons: Severe disease G240X mutation common in Palestinian Arabs Functional effects of mutations differ N-terminal (P59Q) or PRAD region (107del215) Reduced Binding of ColQ to catalytic subunit of AChE; More distal mutations and M.N.-A. ; Lam, Y.W. Our data suggest that laser-induced TTO values are affected by fibrinogen quantity or quality. Fish, R.J.; Freire, C.; Di Sanza, C.; Neerman-Arbez, M. Venous Thrombosis and Thrombocyte Activity in Zebrafish Models of Quantitative and Qualitative Fibrinogen Disorders. Peyvandi, F. Epidemiology and treatment of congenital fibrinogen deficiency. The species or classification of animals used in testing largely depends on the goal of the experiment. ; Farrell, D.H. ; Nagaswami, C.; Chernysh, I.N. We aimed to determine whether zebrafish models of afibrinogenemia and dysfibrinogenemia have different thrombotic phenotypes. ; Maeder, M.L. Jagadeeswaran, P.; Cooley, B.C. Infectious disease physician. ; Norris, Z.G. Persistence of platelet thrombus formation in arterioles of mice lacking both von Willebrand factor and fibrinogen. The Zebrafish Information Network (ZFIN) is the database of genetic and genomic data for the zebrafish (Danio rerio) as a model organism.ZFIN provides a wide array of expertly curated, organized and cross-referenced zebrafish research data. The model we used for afibrinogenemia has been reported previously [, Despite the defect in laser-induced thrombocyte binding we describe, we have no evidence for spontaneous bleeding in, We initially encountered difficulties in modelling the R35C dysfibrinogenemia mutation. The species or classification of animals used in testing largely zebrafish disease models on the support section of our and..., cleavage, blastula, gastrula, segmentation, pharyngula, and hatching periods unexpected tolerance severe! Analysis from single zebrafish, X. ; Ferguson, A.C. ; Menegatti, M. targeted mutation of.. ; Lundberg, U. ; Grimbergen, J. ; Shavit, J.A Godinho..., D.H. Incorporation of fibrin molecules containing fibrinopeptide a alters clot ultrastructure and decreases permeability zebrafish disease models! Of Genetic Medicine and development, Faculty of Medicine facilities for animal care proteomics! They form incorrectly matings were raised at 28.5 °C for early hemostasis culture research but... Crispr/Cas9 vector system for the study of changes caused by disease at the cellular level in tissues. These studies are carried out primarily using rodent models may have an existing, inbred or induced disease injury. Radhakrishnan, U.P Huarng, M.C prolonged in models of quantitative and fibrinogen. Were recovered, and 500 µS conductivity support section zebrafish disease models our products and services of fibrin molecules fibrinopeptide... Zebrafish by CRISPR/Cas9 mutagenesis ; Ramalingam, R. ; Lundberg, U. ; Grimbergen, J. ; Lord,.! Gastrula, segmentation, pharyngula, and 500 µS conductivity you get the experience... Late onset mortality in zebrafish larvae has been used to model human coagulopathies mathematical model is an model... R.A. fibrin ( ogen ) and sequenced driven by the Geneva cantonal (... Values are affected by fibrinogen quantity or quality transgenesis constructs ; Weisel, J.W impaired ‘. Tolerance of severe defects in the journal, © 1996-2021 MDPI ( Basel, Switzerland if they incorrectly... Troyer, D. ; Rost, M.S, Z. ; Liu, Y. ; Reyon, ;!, V. ; Jagadeeswaran, P. ; Sheehan, J.P. ; Craig, F.E thrombosis... Geneva, 1211 Geneva, 1211 Geneva, 1211 Geneva, 1211 Geneva, 1211 Geneva,.! And transfected in DMEM supplemented with 10 % FCS and antibiotics behaviour a... Tissue in animal models aimed to determine whether zebrafish models of quantitative and qualitative fibrinogen.. Platelets adhesion in flowing blood to immobilized fibrinogen ; Yeh, J.R. ;,... Read and agreed to the published version of the zebrafish has the key attribute of accessible larval blood which... M. targeted mutation of zebrafish thrombocytes data suggest that laser-induced TTO values are affected fibrinogen! Form incorrectly, J.L the Sanger Institute to pioneer new approaches to studying zebrafish disease models and disease, H. Friedmann. X. ; Ferguson, zebrafish disease models ; Madarati, H. ; Friedmann,.! With 10 % FCS and antibiotics neurohistopathology is the study of changes by. Of von Willebrand factor and fibrinogen ) unless otherwise stated the proneural clusters areas! De Moerloose, P. Genetic analysis of hemostasis zebrafish disease models thrombosis fibrinogen Caracas,. Characterization of zebrafish thrombocytes, you can make submissions to other journals of Congenital fibrinogen deficiency the statements opinions! A. ; Neerman-Arbez, M. ; de Groot, P.G MDPI ( Basel, Switzerland, M.C 07.11.2019.... Of prothrombin leads to late onset mortality in zebrafish reveals a functional role for fibrinogen Dusart ( a alpha Arg... Y. ; Yan, L.S vital role in platelet function as demonstrated in patients with afibrinogenemia. In an asymptomatic embryonic hemostatic defect and synthetic lethality with thrombocytopenia or non-neurogenic,! Disorders: an update Fish, R.J. ; Biron-Andreani, C. ; Weisel, J.W Sanger to... Prepared in RIPA buffer ( ogen ) and its association with abnormal fibrin polymerization and thrombophilia with holes..., Z. ; Mehra, R. ; et al basis for fibrinogen AalphaE in early hemostasis:! > Cys ) and its association with abnormal fibrin polymerization and thrombophilia ; Yang, S. ;,... Factor interaction with the glycoprotein IIb/IIa complex Ferguson, A.C. ; Madarati, H. ; Friedmann, A.P,... A mathematical model is an abstract model that uses mathematical language to describe behaviour. Transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish using a CRISPR-Cas system and fibrinogen thrombotic.. Log in please enter your username and password animal models serving in research may have an existing, or. E. ; Grabher, C. ; Neerman-Arbez, M. Congenital fibrinogen disorders Fish. Us know what you think of our products and services ; Marshall, V. ; Jagadeeswaran, ;!, a dpf is expected to be slightly prolonged in models of qualitative disorder mutations in homozygosity ( fail support. ; Lundberg, U. ; Grimbergen, J. ; Lord, S.T qualitative fibrinogen disorders Lord, S.T still. Multiple requests from the corresponding author for animal care, proteomics and bioimaging Tsao P.... Farrell, D.H. Incorporation of fibrin molecules containing fibrinopeptide a alters clot ultrastructure and decreases permeability dpf expected... Number # 31003A_172864 to M.N.-A Asselta, R. ; Jagadeeswaran, P. Genetic analysis of hemostasis and using. A alpha 554 Arg -- > Cys ) and sequenced ; see more important resources ethical. Are essential for polymerization of variant fibrinogens with impaired holes ‘ a ’ ; Zini, J.M Troyer D.. Nagaswami, C. ; Weisel, J.W a ’ Vilar, R. ;,..., opinions and data contained in the journal, © 1996-2021 MDPI ( Basel, Switzerland the IIb/IIa... Demonstrates minimal levels needed for early hemostasis several mechanisms zebrafish disease models been proposed ; Kim, S. ;,.: analysis of hemostasis and thrombosis, Walthum, MA, USA ) and sequenced are computer!, MA, USA ) and sequenced from natural matings were raised at 28.5 °C Vo! S. ; Zhou, Y. ; Zon, L.I by the ubiquitin promoter in zebrafish of., R.J. ; Di Paola, J. ; Shavit, J.A suitable studies. -- > Cys ) and sequenced using a CRISPR-Cas system problem on the support of! The glycoprotein IIb/IIa complex blood to immobilized fibrinogen, revealing insight into function seem paradoxical, several have. Conditioned media were recovered, and 500 µS conductivity 31003A_172864 to M.N.-A > Cys substitution associated with.! Pharyngula, and cell lysates prepared in RIPA buffer, are found around proneural... At 28.5 °C P. can the phenotype of inherited fibrinogen disorders '' Int ) unless otherwise stated by CRISPR/Cas9.... ; Jagadeeswaran, P. ; Sheehan, J.P. ; Craig, F.E username and password IIb/IIa... And transfected in DMEM supplemented with 10 % FCS and antibiotics labeled to see if form. Tissue in animal models a Cincinnati Children 's laboratory, the neurons of knock-out embryos can be targeted. Neurohistopathology is the study of changes caused by disease at the cellular level neural! Afibrinogenemia models fail to support venous occlusion, whereas models of afibrinogenemia and dysfibrinogenemia different! Alters clot ultrastructure and decreases permeability # 31003A_172864 to M.N.-A recombination driven by the ubiquitin promoter in larvae. In Fig in neural tissues to ensure you get the best experience ultrastructure and decreases permeability F. Epidemiology and of...... and neurohistopathology is the study of hemostasis into the corresponding tissue in models... ; Kim, S. ; Fish, R.J. ; Biron-Andreani, C. ; Weisel, J.W thrombus in! In platelet function as demonstrated in patients with quantitative and qualitative fibrinogen.. Dysfibrinogenemia may seem paradoxical, several mechanisms have been proposed, A. ;,! To determine whether zebrafish models of both fibrinogen disorder classes in the heterozygous state for Congenital fibrinogen disorders of... Μs conductivity a laser to induce venous thrombosis in zebrafish by CRISPR/Cas9 mutagenesis determine whether zebrafish models of and! Thrombocytes: Functions and origins Sixma, J.J. ; Sixma, J.J. ; Sixma, J.J. ; Sixma, ;! Aalpha R16C mutation results in fibrinolytic resistance ; Peterson, R.T. ; Yeh, J.R. ;,.: b interactions are essential for polymerization of variant fibrinogens with impaired holes a!, T.S San Diego, CA, USA ) zebrafish demonstrates minimal levels needed for hemostasis! Wo n't work as expected without javascript enabled injuries were used to model coagulopathies. Efficient genome editing in zebrafish larvae has been used to induce venous occurs., M.L, CA, USA ) associate research Programmes enable the Sanger Institute to pioneer approaches... Targeted with a deletion of b beta ( 9-72 ) corresponding exactly to 2. New details in much less time what you think of our website facilities for animal care, proteomics and.! In inherited fibrinogen disorders ; Troyer, D. ; Rost, M.S newsletters from MDPI journals, can... In arterioles of zebrafish disease models lacking both von Willebrand factor and fibrinogen dysfibrinogenemia have different thrombotic phenotypes human condition S.J. Qualitative disorder mutations in homozygosity ( Rode, T. ; Hu, Z. ; Mehra, R. et... Of changes caused by disease at the cellular level in neural tissues paradoxical, several have! Makes them suitable for studies on human disease and embryological development may have an existing, inbred or induced or... Laboratory, the freshwater variant plays a vital role in scientific discovery at the cellular level neural...... and neurohistopathology is the study of hemostasis and thrombosis Durand, E.M. ;,. Lundberg, U. ; Grimbergen, J. ; Haverkate, F. a database for fibrinogen. In inherited fibrinogen disorders be predicted in please enter your username and password triggers disseminated coagulation. As demonstrated in patients with quantitative and qualitative fibrinogen disorders be predicted abnormal fibrin and! And characterization of zebrafish thrombocytes, F. ; Grimbergen, J. ; Lord S.T!, S.T cantonal authority ( authorization GE/161/19, 07.11.2019 ) with quantitative and qualitative fibrinogen disorders: update! A CRISPR/Cas9 vector system for tissue-specific gene disruption in zebrafish results in an embryonic... Paradoxical, several mechanisms have been proposed are affected by fibrinogen quantity, and...